Acabo de llegar de pasar las primeras vacaciones del año, he estado en Alaska pescando salmones, estuvimos alojados en un lodge de pesca de la empresa Alaska Robin Fishing.

Un viaje preparado hace ya un tiempo y con mucha ilusión ya que lo compartía con mi padre y Carlos un amigo de hace muchos años y que no dudo en decir si cuando le llame para proponerle esta aventura.

Un viaje largo, de casi 17 horas y en el cual nos dio tiempo de conocer a los pescadores con los cuales íbamos a compartir esta semana.

En la foto recién llegados Diego, Javi, Roberto, Antonio, Carlos, mi papa y Guy Roches, faltaban Diego, Álvaro y Jesús que aun no les conocíamos.

P1030631

Llegamos el sábado a las 12 del medio día, y tras venir a buscarnos nos dirigimos a unas tiendas de pesca para comprar material para la semana, hilos para bajos, plomos, etc. y anti mosquitos, como pican!!

Llegamos al logde y pudimos comprobar el espectacular enclave en el cual estábamos, rodeados de naturaleza y a tan solo 50 metros del rio Montana, el cual nos dio una increíbles alegrías esa semana.

SANY0073

Fue llegar dejar la maleta y ¿que es lo importante, ordenar la ropa o montar las cañas y salir al rio a tirar unos lances? ya os podéis imaginar en 10 min ya estábamos tocando el río.

Llegar y besar el santo, segundo lance y clave un salmón, Carlos no se lo creía, y tras bajar al siguiente pozo pude sacar el primero, un pequeño salmón King que tras la foto fue devuelto al agua.

SANY0114

La cosa no empezaba mal, se veían salmones y tras quitarnos el mono del viaje a descansar que la jornada que venia se presentaba llena de ilusión.

Domingo 24 de julio 

8:00 a.m tocaba el despertador de Carlos con Lady Gaga a tope, vestirnos y a desayunar.

Las jornadas de pesca eran de 8:00 a 16:00 mas o menos todas ellas guiadas, este primer día nos llevaron a pescar a la desembocadura del rio Montana.

IMG_0001

Utilizamos cañas de 9 pies, líneas del nº 9 semi-hundidas y con bajos de línea en torno a los 3 metros con acabados en un 30 si pescábamos Salmones Pink, Sockeye, Chum o Silvers y un 50 si lo que queríamos era tentar el salmón King.

Los primeros salmones Chum y Pink no tardaron en aparecer, no dudaban en atacar los strimmers rosa con cabeza plomeada que junto a unos negros y los jigs montados por Álvaro en color rosa fueron los que mejores resultados nos dieron.

IMG_0015 IMG_0020

Mi padre con su primer salmón, un sueño echo realidad, él pesco con una caña de spinning de 3 metros y con cucharillas vibrax del nº 5 y 6, también utilizo strimmers que le dieron buenísimos resultados.

IMG_0032 IMG_0034

Un primer día que colmo nuestras mejores expectativas, con muchísimas picadas y que sacamos entre los tres ( Carlos mi padre y yo) unos 50 salmones, todos ellos devueltos.

Nos fuimos al lodge a descansar ya que llevábamos un buen tute pero fue reponer fuerzas y acercarnos de nuevo tramo medio del rio Montana y el salmón King tampoco falto a su cita, esta vez clavamos varios y Carlos saco uno de tamaño pequeño pero que le dio su batalla.

SANY0151

Lunes 25 de julio

Una vez recargadas las pilas, en esta jornada pescamos el rio Willow, también nos dirigimos a su desembocadura, un bonito entorno que ya merecía la pena. La afluencia de gente nos decía que había muchos salmones y así fue.

Diego con un de los muchos que saco ese día, a partir de este día nos hicimos inseparables para la futuras jornadas.

SANY0132

El salmón Chum, daban mucho juego estos salmones de entre 4 y 6 kilos y te hacían pasar un buen rato.

SANY0126 SANY0133

Carlos con un salmón silver o coho, no había mucha subida de estos pero pudimos sacar algunos, comprobar su fuerza y los saltos que daban.

IMG_0049

Terminábamos la jornada muy felices por lo conseguido y por lo tanto que disfrutamos este día, compartir jornadas de pesca con gente con tantos años en este arte te llena muchísimo por lo mucho que se aprende de ellos.

Guy Roches, Jesús Rioyo y yo con 3 salmones silvers.

IMG_0085

Martes 26 de julio

El día de la locura del año, así lo describió Carlos y no iba desencaminado.

Robin nos propuso un mini viaje en avioneta para pescar el salmón Sockeye en el rio Lake, este salmón hace la freza en los lagos así que solo sube en ríos que nacen el ellos. Sin pensarlo mucho aceptamos la aventura y nos montamos rumbo a este precioso rio.

IMG_0096  IMG_0099

Al principio de la mañana no había mucha actividad de estos salmones y prácticamente no se veían subir, por lo que había que pasar el tiempo, pusimos una cucharilla del nº2 y saque esta trucha arcoíris al segundo lance.

IMG_0120 

Carlos y yo decidimos subir rio arriba y buscar los salmones, para nuestra sorpresa y tras ver unos salmones King al poco rato Carlos clavo uno de los mas grandes que he visto. Llevaba una caña de dos manos muy potente con la que pudo librar una batalla preciosa y la cual recordara para siempre, al igual que yo.

Tras más de media hora y con el brazo ya cansado pudimos verlo, yo lo intente coger de la cola una vez lo cual me fue imposible ya que no me abarcaba mis dos manos para agarrarlo.

Solo fijaros en la curva de la caña!!! que pasada…al final se soltó.

IMG_0125

Una vez pasado este lance, ya empezamos a ver salmones subir, era entorno a las 14:00 de la tarde, se veían subir muy próximos a la orilla, subían con la boca abriéndola continuamente, el lance era muy rápido, lo veías y subías rio arriba por la orilla tirándole el strimmer por delante e intentando pasárselo lo mas cerca de la boca posible.

Una vez clavados la fuerza que tenían era increíble y corriente abajo íbamos detrás de ellos unos cuantos metros para luego vararlos en la orilla.

IMG_0126 IMG_0128

IMG_0136

Una gran experiencia la pesca de este salmón la cual es mas compleja de lo parece por lo menos en el entorno en el que estuvimos, aun así sacamos 7 salmones Sockeye.

Miércoles 27 de julio

Comenzamos el día de compras, bajamos a Wasilla a comprar una botas y un vadeador para Carlos ya que el suyo estaba hecho unos zorros.

Tras las pertinentes compras nos dirigimos al curso medio-bajo del rio Montana,  enseguida vimos los bancos de salmones que se apostaban en el lecho del rio. Estaban mezclados los Chum y los Pink.

No tardamos en sacar los primeros salmones y así estuvimos 3 horas sin parar, era un no parar continuado.

IMG_0165

IMG_0170

Ya una vez saciados de pescar en esta parte del rio y como una tarde mas, estuvimos en nuestro coto particular, el cual nos dio unos cuantos salmones King que sin dudarlo te ponían los equipos al nivel mas alto de exigencia.

IMG_0158

IMG_0159

 

Jueves 28 de julio

En este día repetimos pesca en el rio Wilow, mas concretamente llegamos a su desembocadura, los papas se quedaron en una zona mas cómoda y Álvaro, Diego, Carlos y yo pescamos rio arriba unos dos kilómetros.

La zona muy bonita, repleta de salmones Pink y Chum como se puede ver en estas fotos.

SANY0187 SANY0189

Pescamos muchas posturas con una pesca muy activa e interesante, pero en un pozo en concreto se encontraban un buen numero de Chums, nos dieron una hora y media espectacular, estaban muy activos y no dudaban en atacar los strimmers o las cucharillas vibrax de nº5.

IMG_0178 IMG_0180

Un triplete de salmones Chum

IMG_0188 

Un doblete con Carlos como disfrutamos todos en este rio.

IMG_0189

Acabamos la jornada guiada y nos fuimos al lodge a reponer fuerzas, tras descansar un ratito hablamos y decidimos bajar dar una vuelta por el rio Montana.

Observamos que había varios salmones King de gran tamaño, nos pusimos a su altura y no tardamos en clavar varios de ellos, teníamos ganas de hacernos la foto con uno grande de verdad y los días iban pasando sin lograrlo, eso se acabo ya que después de unas bonitas luchas conseguimos lo que queríamos.

Foto con mi padre con la cual se cumplía otro mini sueño, pescar un salmón King junto a él.

IMG_0197

Un gran salmón King macho como se puede observar por la pronunciada mandíbula y eso picos característicos.

Es lo máximo tener un animal de estos en los brazos.

IMG_0213 

Otro King parecido al anterior que nos dio muchísima batalla, nos hizo sudar para sacarlo pero lo conseguimos. Con este se acabo la jornada, la cual la exprimimos a tope y la recodaremos por ser un gran día de pesca.

IMG_0228 

Viernes 29 de julio

Se acaba la semana de pesca y con ella poníamos una guinda en el pastel, íbamos a pescar el popular rio Clear Creek el cual desembocaba en el rio Talkeetna.

Su acceso se hacia mediante embarcación, una pequeña planeadora para 6 ocupantes, navegamos por el rio Talkeetna unos 20 minutos hasta llegar al punto de pesca.

IMG_0230

La zona era bastante popular y así lo comprobamos, aunque el lugar es bastante remoto, los guías llevan a sus cliente a esta zona con muy buenos resultados.

En unos 100 metros de rio, se concentraban cientos de salmones Chum y la gente daba cuenta de ello sacando continuamente salmones, miraba a mi alrededor y veía hasta 7 personas con un salmón clavado.

Entraban especialmente bien con cucharillas, en el caso de los pescadores de lance y los que pescábamos con mosca, strimmers negros o moscas de tubo negras eran las mas efectivas.

IMG_0235 IMG_0238

SANY0225 SANY0227

IMG_0242

Después de un par de horas sacando salmones, una vez más Carlos, Diego yo nos fuimos de excursión rio arriba para pescar tranquilos alejados del gentío. El escenario de pesca nuevamente era precioso, aguas cristalinas, bosques frondosos a nuestro alrededor y lo mas importante salmones por todos lados.

SANY0231 

Nosotros a lo nuestro y tras llegar a unos pozos, divisamos salmones King, son irresistibles. Su tamaño, su fuerza, sus saltos los hacen especiales.

Este ultimo tramo del día, nos paso de todo, desde ver a Carlos bajar rio abajo medio flotando con un King clavado, parecido a Brad Pitt en la película “El rio de la vida”, hasta sacarme un Salmón King los 30 metros de cola de rata y casi todo el backing del carrete, algo que queda en nuestras retinas para siempre.

Algunos de los mejores Salmones del Clear Creek.

SANY0265

IMG_0271

IMG_0274 IMG_0275

 

Con esto acabábamos nuestra pesca en Alaska de la mano de Alaska Robin Fishing, con una pesca extrema y divertida, con diferentes escenarios todos los días y un Lodge situado en una zona privilegiada.

Para mi ha sido mi segunda experiencia en Alaska y sin duda ha sido increíble,  ni en mis mejores sueños he pescado tanto, con la compañía de mi padre que la hacia muy especial.

También ha sido genial el grupo de personas con los que hemos compartido estos días, todos ellos grandísimos pescadores y con los que he aprendido y disfrutado mucho.

 

Hasta pronto…

Comments (15)

On 6 de agosto de 2011, 16:29 , ANDER.Z dijo...

AUPA TXEMA

Joder,joder,joder , eso no se publicaaaaaaaa!!!!

Veo que tus vacatas han ido algo mejor que las mias jejeje.

Me alegro de que cumplas tus sueños y disfrutes tanto.....enhorabuena campeón,envidia cochina y grande la que me da jeje.

UN SALUDO AMIGO

 
On 6 de agosto de 2011, 17:03 , Fermíntxo dijo...

GUUUUUUUAAAAAAAUUUUUUUUU !!!!!!
Vaya experiencia Txema.
Ya tengo ganas de darme un homenaje de esos,ha tenido que ser una experiencia inolvidable..
Que conste que he tenido que secarme las babas antes de escribir..
Felicidades por esas jornadas...
PD.Tú habrás disfrutado con tu padre pero él..
S2

 
On 7 de agosto de 2011, 15:13 , " ARGUA" dijo...

Apa Txema,

>Envidia de la sana jejejej menudo peazo de viaje, que lo disfrutasteis esta claro solo hay que ver vuestras caras, menuda gozada sacar eso bichos tangrandes. Por lo menos no gfue en balde ir asta Alaska y asi si se puede ir uno de vacatas.

Enhorabuena por ese sueño ya cumplido y ahora a por el otro......

Saludos.

 
On 8 de agosto de 2011, 23:15 , chema san martin fernandez dijo...

Gracias Ander,
si si hemos disfrutado mucho, ha sido increible esta experiencia, esto va aser dificil de superar.
un abrazoo ander

 
On 8 de agosto de 2011, 23:19 , chema san martin fernandez dijo...

Jaja muchas gracias Ander, pues no es para tanto ir tan lejos, parece mas de lo que es, de verdad,
yo he disfrudo doble ya que he disfrutado yo mas ver a mi padre hacerlo

saludos pescador!!

 
On 8 de agosto de 2011, 23:22 , chema san martin fernandez dijo...

Aupa Argua, ya sabes que la pesca es una incognita a veces y ver que todo ha salido tambien pues te alegro mucho a posteriori,

gracias y a seguir bien un abrazo campeon

 
On 10 de agosto de 2011, 19:03 , XONDIO dijo...

Una pasada de viaje. Solo falta unos Sargos para ser perfecto.
Ahora en serio, envidia sana ver lo que pescasteis, en esos bonitos rios
Saludos

 
On 10 de agosto de 2011, 23:11 , carlos(the king on salmon) dijo...

falto escribir yo como amigo y compañero de pesca de chema y su padre,lo primero decir que ni en lo mejor de mis sueños esperaba haber disfrutado tanto con la pesca y la compañia de chema y su padre igual que el grupo de gente que conocimos,en especial a diego rioyo, alvaro , jesus,diego teixeira, javi rubio,anton roberto,guy roques,pepe, carlos,hilario,marcos y alvaro de galicia.de los peces que decir me lo he pasado pipa con las peleas tenidas con estos formidables animales.los paisajes son salvajes y bonitos.ha sido un sueño echo realidad. dar las gracias a chema por ofrecerme esta oportunidad ,de la que no se me olvidara en la vida. gracias

 
On 10 de agosto de 2011, 23:43 , chema san martin fernandez dijo...

jajaj pues si Xondio la verdad que unos sargos tampoco me hubiese importado pero tenian que ser del tamaño proporcional a los salmones,
lo del paisaje la verdad que increible!!!
un cordial saludo

 
On 10 de agosto de 2011, 23:50 , chema san martin fernandez dijo...

Carlos, Carlos me siento muy agradecido por tus palabras, ya sabes como es la pesca, la incognita que es siempre que se va pero para mi ha sido una doble satisfaccion que tanto tú como mi padre lo habeis pasado muy bien y que habeis pescado mucho y muy bien.
Gracias por todo a ti tambien y espero que esta haya sido la locura de este año, y la he propuesto yo, asi que vete preparando la siguiente, sera todo un placer el oompartir contigo otra aventura.

Un abrazo grande señor King Salmon.

 
On 11 de agosto de 2011, 1:05 , felipe dijo...

Chema majo, vaya semanita de ensueño. Ahora las truchas de mansilla te pareceran alburnitos.
Y mira que me dijiste veces que os acompañara, cachis,hay trenes que solo pasan una vez. Espero que este pase de nuevo y pueda subirme.
O a ver si crece pronto mi nene y me lleva a mi , como tu a tu papi. Bueno chema me alegro que todo salio tan bien, ya me paso un dia a tomar un cafe y me pones de los nervios.

 
On 13 de agosto de 2011, 0:20 , BASILIO TORRES dijo...

Joder Chema, yo en el pantano de Prada en la localidad de A Veiga (Orense) intentando pescar lo que sea, es decir, na de na (lo del agua dulce no es lo mio), y vosotros hinchados a sacar salmones, menuda envidiaaaaaaa...... Y, además de estar entre amigos, has contado con la inigualable compañía de tu padre, se puede pedir mas?????
Un fuerte abrazo y mi mas sincera enhorabuena campeón....

 
On 15 de agosto de 2011, 0:15 , Alvaro Rioyo dijo...

Chema, muy buen relato, eres un gran narrador.
Mi padre, mi hermano y yo lo pasamos muy bien esa semana en compañía de Chema hijo, padre y Carlos, grandes pescadores y mejores personas.
La semana salió genial gracias al entusiasmo y compañerismo de todo el grupo de pescadores, entre los que estaban Guy, Antón, Roberto, Diego, Javi, Pepe, Carlos, Hilario y Marcos.
Espero que nos volvamos a ver pronto para ir a por algún bicho grande, que las truchas y sargos se te van a quedar pequeñas.

 
On 30 de agosto de 2011, 22:28 , erickelrojas dijo...

Buena es la trucha, aunque mejor el salmón pero yo prefiero un buen jamón.

Que hermosos el Salmón King macho que tienes en los brazos ...debes sentirte todo agusto después de haberlo pescado ...muy guapas las fotos tio.

 
On 17 de mayo de 2012, 11:19 , Joseba dijo...

Hola Chema. Estoy pensando regalarle ese viaje con la misma empresa a mi padre. Te agradecería me mandases información de precios por persona aproximados, incluido vuelo al email siguiente: josebamanso@hotmail.com
Gracias por todo y por compartir con el resto semejante aventura. Saludos